DNA Fingerprinting
Scientists first discovered DNA in the 1800’s but it had no interest for the legal system until 1985
when___________________________ revealed his research that suggested that DNA is a unique as a
fingerprinting. (thus the term DNA fingerprinting)
The Basics
We have about 60 trillion cells and each of those cells contains a full set of our chromosomes
_________(2 sets of 23) in a regular cell
23 (one set) in a __________________
You inherit 1 set of chromosomes (23) from your mother and one set (23) from your father.
Your sex cells (sperm or egg) only have ______________ that is randomly made from a mixture of your two sets.
The Basics
Chromosomes are found in the _________________________
They typically take the form of _____________________
Chromosomes are made of_________ (deoxyribonucleic acid). DNA is in the shape of a spiral double helix
(twisted ladder)
DNA has three parts
Sugar (deoxyribose
_______________________
Nitrogen base (Adenine, Cytosine, Thymine, or ___________________)
The sugar and phosphates make up the sides of the ladder. The __________________ make up the rungs.
DNA
It is the sequence of ________________________ (A,C,T, G) that make each person’s DNA unique.
A is always found paired with T; _______________________________________________________
However, the large majority of the sequence is identical person to person (99.9%)
It is the _____________ difference that causes us to be unique.
There are about ________________________________ in a Human’s DNA.
The Basics
On those chromosomes there are about _________________________.
Genes are the basic unit of heredity.
Each gene has a single function (in other words it codes for a single protein.)
It codes for something by having a specific set of ______________________.
A change in the base pair order can change what the gene codes for.
Together, the proteins our genes code for make us who we are.
Alleles
Each person has _______________________ of each gene (one from each parent)
Those two copies are referred to as ____________________from that gene.
If the alleles are the same we say the person is____________________________
If the alleles are different we say the person is ____________________________
Tandem Repeats
A region of a chromosome that contains multiple copies of a DNA sequence arranged in a repeating fashion.
CAGCAGCAGCAGCAGCAGCAGCAGCAG
Roughly ___________________ of our DNA
Large variation in number of repeats from person to person. (This is what makes our DNA unique)
Follow basic Mendelian inheritance (Think Punnett Squares)
Genome
_______________________________________________________________________________
Docsity.com
